На главную ДЛЯ НОВИЧКОВДЛЯ НОВИЧКОВ СОБЫТИЯ КАРТА САЙТА ПРЕСС-СЛУЖБА
ДЛЯ СПЕЦИАЛИСТОВДЛЯ СПЕЦИАЛИСТОВ ДАТЫ ПОЛЕЗНЫЕ ССЫЛКИ О ПРОЕКТЕ
ДЛЯ ИНВЕСТОРОВДЛЯ ИНВЕСТОРОВ КОМПАНИИ ГОСТЕВАЯ НАГРАДЫ
SWITCH TO ENGLISH СТАТЬИСТАТЬИ БАЗА ДАННЫХ ФОРУМ КОНТАКТЫ
поиск по сайту  
подписка  


Биотерроризм

Биокомпьютеры

С-пептид. Часть III.

С-пептид. Часть II

С-пептид. Часть I.

Инсулин. Часть II.

Инсулин. Часть I.

Атипичная пневмония. Часть II.

Атипичная пневмония. Часть I.

Геносистематика - что это такое Часть 2.

ДНК или РНК: кто более матери-Природе ценен?

Будущее коммерческого внедрения генетически модифицированных организмов в странах европейского союза

Простая модель реакции организма на внешние воздействия

Некоторые современные подходы к терапии болезни Альцгеймера

Болезнь Альцгеймера. Молекулярно-биологический аспект. Часть II

Болезнь Альцгеймера. Молекулярно-биологический аспект. Часть I

Болезнь Альцгеймера. От описания симптомов - к молекулярным механизмам.

Главный комплекс тканевой совместимости человека (HLA). Часть 5

Главный комплекс тканевой совместимости человека (HLA). Часть 3

Главный комплекс тканевой совместимости человека (HLA). Часть 2

Главный комплекс тканевой совместимости человека (HLA). Часть 1

«Страшная» еда

Эглин

Почему философия не удовлетворяет биолога?

Инвестиционная привлекательность Российского рынка биоинформатики и биотехнологий

Геносистематика - что это такое.

Эндотоксины Bacillus thuringiensis

Диабет. (часть II)

Вешенка и человек

Диабет. (часть I)

Почему ограничены размеры бактериальной колонии?

Функциональная роль остеопонтина в развитии и реконструкции костной ткани.

Структура и некоторые свойства белка остеопонтина.

Проблемы инвестирования в биотехнологические разработки для сельского хозяйства.

Роль метилирования ДНК в канцерогенезе.

Жизнь и смерть овечки Долли

Дню борьбы с проказой посвящается...

Бактерии, приносящие миллиард.

Дню борьбы со СПИДом - достойные проводы!

Современная лаборатория молекулярной биологии.

Интервью с вампирчиком.


Наши статьи



Атипичная пневмония
или
SEVERE ACUTE RESPIRATORY SYNDROME (SARS).


Часть II.
Клиническая картина атипичной пневмонии.

С момента возникновения этого многострадального со всех сторон заболевания, медики и биологи уже собрали достаточное количество материала, который позволяет во всей красе представить клиническую картину SARS. В совместной публикации ВОЗ, СDC (Center for Diseases Control and Prevention, Атланта) и Health Canada были суммированы данные историй болезни пациентов с диагнозом ТОРС (SARS) начиная с середины февраля 2003. 26 марта ВОЗ были опубликованы результаты проведения виртуального круглого стола, в котором участвовали 80 клиницистов из 13 стран занимающихся исследованием "атипичной пневмонии" . В этом отчете были собраны все данные, полученные мировым медицинским сообществом с ноября 2002 г.

Согласно обобщенным данным, большинство зарегистрированных больных "атипичной пневмонией" - взрослые люди в возрасте 25-70 лет. Несколько случаев заболевания отмечено у детей до 15 лет. Инкубационный период обычно 2-7 дней; однако в отдельных случаях может достигать 10 дней. Клинические признаки в начале заболевания неспецифические, характерны для большинства простудных заболеваний. Продромальный период (период появления симптомов-предвестников болезни) в подавляющем большинстве случаев характеризуется высокой температурой - больше 38°С, сопровождающейся ознобом, миалгией, головными болями. У некоторых больных присутствовали симптомы со стороны респираторной системы. Сыпь, неврологические или желудочно-кишечные признаки обычно отсутствуют, однако в некоторых случаях отмечалась диарея в начальном периоде во время лихорадочного состояния.

Через 3-7 дней наступает стадия развития заболевания, связанная с поражением нижних дыхательных путей, появлением характерного сухого кашля и одышки, которые могут сопровождаться прогрессирующей гипоксимией. На этой стадии больные разделяются на две группы. У большинства (80-90 % заболевших) в течение последующих 6-7 дней наблюдается улучшение состояния и симптоматики. Во второй, меньшей группе (10-20% случаев) проявляется более тяжелая форма "атипичной пневмонии": у многих пациентов развивается острый респираторный дистресс-синдром и требуется интубация и искусственная вентиляция лёгких. Смертность во второй группе высока, и может быть связана с наличием у больных, кроме ТОРС, других заболеваний.

Рентген грудной клетки многих пациентов не выявляет никаких изменений в органах в течение продромальной и респираторной фазы. Однако у значительной части больных респираторная фаза характеризуется двусторонними изменениями в виде внутритканевых инфильтратов, которые развиваются в более генерализованные образования. Эти инфильтраты дают на рентгеновских снимках специфическую картину лёгких, испещренных пятнами (такую картину иногда можно наблюдать уже на 3-4 день заболевания).

Вот так распределяются первичные симптомы среди 144 больных, обследованных группой китайских медиков.

Симптом Число (%) пациентов (n=144)
Температура (n=106 )
Только температура 33(23)
С продромальным периодом А) 33(23)
С продромальным периодом, кашлем или одышкой 16(11)
С кашлем или одышкой 15(11)
В других комбинациях 9(6)
Только продромальный период 19(13)
Только кашель или одышка 13(9)
Первые отмеченные симптомы
Продрома 74(52)
Повышение температуры class="text"106(74)
Кашель или одышка 51(35)
Диарея 9(6)

А) продромальный период включает в себя головную боль, миалгию и общее плохое самочувствие

На ранних этапах развития заболевания абсолютное число лимфоцитов часто уменьшается. На пике респираторного периода примерно у половины пациентов наблюдается лейкопения и тромбоцитопения. Так же в момент развития основных симптомов заболевания происходит повышение уровня креатин-фосфокиназы (до 3000 IU/L) и печеночной трансаминазы (в 2-6 раз по сравнению с нормой). У большинства больных почечной недостаточности не наблюдается. Так же при лабораторных исследованиях выявляется увеличение уровня лактатдегидрогеназы (87%), гипокальцимия (60%), лимфоцитопения (54%).

Изменения в легких.

Патологоанатомическое исследование пациентов, умерших от атипичной пневмонии в китайской провинции Гуандун, Гонконге и Сингапуре продемонстрировало диффузные альвеолярные повреждения практически во всех обследованных легких. Цитологический анализ обнаружил множественность ядер, цитомегалию, нуклеомегалию, отсутствие хроматина и выступающее ядрышко. Хотя такие изменения в клетках летальны, они не являются чем-то характерным именно для этого заболевания. В дополнение к диффузным альвеолярным повреждениям наблюдается разделение бронхиального эпителия, потеря клетками ворсинок и сквамозная (чешуйчатая) метаплазия. Некоторые исследователи отмечали так же внутриальвеолярные геморрагии, гемофагоцитоз, воспалительный некроз в самых мелких дыхательных путях, что само по себе является симптомами пневмонии или провоцировало развитие вторичной бактериальной пневмонии.

Механизм острого легочного повреждения может включать в себя как непосредственно вирусное поражение альвеолярной стенки с повреждением как эпителия так и эндотелия, так и опосредованный вирусом эффект высвобождения клетками в ответ на его внедрение белков-медиаторов воспаления - цитокинов, интерлейкинов и фактора некроза опухоли. Возможно, что тканевые повреждения при атипичной пневмонии не относятся напрямую к вирусной инфекции тканей, а являются вторичным эффектом деятельности цитокинов и других соединений, выброс которых произошел вблизи тканей легкого.

Критерии ВОЗ (кого считать больным, а кого подозревать).

При отсутствии диагностических тест систем на ТОРС (SARS) и сложности дифференцированной диагностики атипичной пневмонии в начале заболевания, в CDC были разработаны критерии для выявления подозрительных и предполагаемых случаев. К "подозрительным случаям" следует относить респираторные заболевания неизвестной этиологии, соответствующие следующим критериям:

  • Повышение температуры выше 38°С.
  • Наличие одного или более клинических признаков респираторного заболевания (кашель, учащенное или затрудненное дыхание, гипоксия).
  • Путешествие в течение 10 дней в пораженные SARS районы мира или общение с больными подозрительными по данной болезни.
    При выявлении "предполагаемых" случаев следует учитывать такие критерии как:
  • Подтверждение пневмонии на рентгеновских снимках или респираторный дистресс-синдром.
  • Данные аутопсии, соответствующие респираторному дистресс-синдрому без идентифицируемых причин.

    Тяжесть течения атипичной пневмонии может варьировать от средней до смертельной. Не у всех людей, контактировавших с больным человеком, развивается тяжелая атипичная пневмония. По данным ВОЗ, среднемировой уровень смертности от этого заболевания достигает 15% (в Гонконге он был несколько выше - 18 %). В качестве индикатора прогноза развития заболевания выделяют возраст - у больных старше 40 лет большая вероятность развития тяжелой формы заболевания и повышенная смертность - до 50%. Среди ученых появилось мнение, что высокая смертность вызвана гиперреакцией иммунной системы больного, как это происходит при некоторых других заболеваниях. Уже через 10 дней после начала заболевания уровень антител в крови больных начинает стремительно расти, а уровень вирусных частиц, соответственно, столь же стремительно снижается. Согласно гипотезе ученых из Гонконгского университета, в начальный период заболевания необходимо снизить количество вирусных частиц, тогда как позднее - снять гипререакцию иммунной системы, применяя иммуномодуляторы. В Гонконге даже пробовали применять иммунодепрессанты для лечения больных SARS.

    Большинство заразившихся до сих пор людей непосредственно общались с носителями вируса, поэтому до недавнего времени считалось, что основным и единственным механизмом передачи SARS-CoV является воздушно-капельный. При таком раскладе распространение заболевания можно предотвратить, поместив больных и подозрительных на карантин. Недавно ВОЗ объявила, что вирус может сохраняться на поверхности, по меньшей мере, сутки. Это означает, что возможны также воздушно-пылевой и контактный механизмы заражения человека, что в значительной мере усложняет медикам задачу и повышает требования к дезинфекции при проведении профилактических мероприятий.

    Возможно, сама проблема SARS несколько преувеличена, однако, самую серьезную озабоченность вызывает одна особенность этой инфекции - высочайшая контагиозность. Атипичную пневмонию часто сравнивают с гриппом, сопоставляя уровень смертности от осложнений, течение заболевания, сходство некоторых симптомов, эпидемичность, наконец. А вот контагиозность (или, по-простому, заразность) SARS-CoV во много раз превосходит инфекционность любого вируса, вызывающего простудные заболевания, в том числе и вируса гриппа. Данное заболевание так же заразно, как корь или ветряная оспа. Стоит только одному заболевающему посетить школу, конференц-зал или институт - в течение двух недель мы будем иметь вспышку инфекции с огромным числом заболевших. Останется только закрыть данные учреждения, поскольку весь персонал будет болен атипичной пневмонией. Вот этот фактор (наряду с 15% смертностью) и остается одним из самых серьезных и острых моментов, требующих максимально быстрого решения вопросов терапии и профилактики.

    Лечение атипичной пневмонии - глава грустная, но необходимая.

    Терапия.

    В настоящее время эффективных методов борьбы с "атипичной пневмонией" нет. Этиологическая терапия (как и для подавляющего большинства вирусных инфекций) не существует. В материалах ВОЗ и CDC рекомендуется включение с первых дней заболевания в схемы лечения нескольких антибиотиков для предотвращения угрозы развития бактериальной инфекции. На практике предпочтение отдавалось антибиотикам широкого спектра действия - ?-лактамам (ампенициллин и др.), фторхинолонам, цефалоспоринам, тетрациклинам.

    Кстати, неплохие результаты, полученные нашими учеными при использовании тетрациклина для лечения вирусного клещевого энцефалита (отчасти это связано с его иммуномодулирующими свойствами) позволяют предположить, что этот антибиотик может рассматриваться и испытываться как потенциальное средство в терапии ТОРС (SARS).

    В качестве основного противовирусного препарата для лечения атипичной пневмонии наиболее широко врачами в очагах заболевания используется рибавирин, один или в сочетании со стероидными препаратами. Показано, что он обладает противовирусной активностью, в том числе и по отношению к коронавирусам. Однако, некоторые исследователи высказывают критическое отношение к применению этого препарата, отмечая случаи ухудшения состояния больных при его приёме.

    В Канаде при поступлении пациента в стационар с признаками простудного заболевания назначалась комбинированная терапия, включавшая антибиотики, активные против большинства вызывающих простуду микробов. Если же у пациента в анамнезе значились поездки в зараженную зону, то назначали внутривенную противовирусную терапию (2 г. рибавирина 4 раза в сутки в первые 3 дня, затем в последующие дни - по 1 г. рибавирина 4 раза в сутки). В отсутствие контролируемых испытаний препаратов, у CDC в настоящее время нет четких рекомендаций как о возможности использования рибавирина и путях его введения (внутривенно и/или в виде аэрозоля), так и о необходимости совместной терапии гликокортикоидами. Весьма вероятно, что применение интерферона и других препаратов этой группы в первые три дня должно снижать тяжесть заболевания, хотя это также требует доказательства. Из центра по изучению СПИДа в Нью-Йорке пришло предложение применить для лечения SARS препарат энфлувертид (фурзеон), предназначенный для лечения СПИДа. Как уже упоминалось, гонконгские врачи начали применять иммунодепрессанты в терапии атипичной пневмонии.

    Итак, проблема поиска специфического препарата пока остается открытой. Несмотря на отсутствие лекарств, эффективных против коронавирусов, многие этапы воспроизводства этого патогена могут подсказать путь к решению данной проблемы (рис.1).

    Рис.1 Стадии репликации коронавируса в качестве потенциальных мишеней для антивирусных препаратов и вакцин.

    Гликопротеин S, венчающий выступы оболочки коронавируса может послужить неплохой и специфической целью, поскольку именно он отвечает за связывание вируса с рецепторами клетки-мишени. Конформационные изменения этого соединения ведут к слиянию вирусной частицы с мембраной. Молекулы, блокирующие связывание с рецептором или же ингибирующие конформационные изменения в гликопротеине могут воспрепятствовать развитию SARS-инфекции. Сходные препараты как раз и были разработаны для атаки на HIV-I (вирус иммунодефицита человека), что может послужить неплохим примером для подражания в хорошем смысле слова.

    Крупная молекула белка - ДНК-полимеразы должна быть разрушена в определенных местах вирусными протеазами, чтобы приобрести функциональную форму. Протеазные ингибиторы, созданные для блокирования сходных процессов при развитии ряда других вирусов тестируются для применения против коронавируса SARS. Так же синтез новых молекул РНК протекает в специфическом месте клетки, окруженном двойной мембраной. Можно ли подавить комплексно все процессы, происходящие в этой органелле, пока не ясно.

    Что касается самого процесса репликации, то РНК генома коронавируса реплицируется дискретно. Возможно, короткие отрезки РНК или другие ингибиторы будут способны остановить такой процесс. Это так называемая десенсибилизирующая терапия, пионером в применении которой считается американская компания AVI BioPharma. Ее специалисты уже нашли последовательность РНК, способную защитить некоторых животных от лихорадки Западного Нила (задача была решена для пингвинов из зоопарка всего за каких-то 2 недели). Короткие сегменты РНК блокируют экспрессию комплементарных последовательностей ДНК. Главное в этом деле - найти специфическую для вируса (в нашем случае SARS) последовательность оснований, не встречающуюся в организме хозяина. Следующим специфическим этапом является самосборка РНК и вирусных белков в вирионы. Так же потенциальной целью может послужить процесс экзоцитоза, при помощи которого вирусы выходят из клетки.

    Кстати, при успешной разработке лекарств по одному из предложенных вариантов, оно может оказаться эффективным и для лечения целого ряда других заболеваний, имеющих серьезный экономический эффект, а так же для терапии коронавирусных инфекций у животных. Таким образом, на настоящий момент терапия ТАРС (SARS) является главным образом патогенетической и симптоматической.

    В начале апреля в газетах появились сообщения об использовании гонконгскими врачами в качестве лекарственного препарата против вируса SARS плазмы крови пациентов, благополучно перенесших инфекцию. Врачи из Госпиталя Принца Уэльского (Гонконг), с помощью переливания плазмы крови переболевших людей больным смогли спасти жизни как минимум 20 больных, находившихся до переливания плазмы в критическом состоянии (см. ссылку [21]). К сожалению, пока не найдено других источников, более подробно описывающих этот опыт. Антисыворотку раньше получали от инфицированных животных. Однако теперь менее опасные (не аллергогенные) антитела можно будет получить в клеточной культуре.

    Вакцина.

    Возможно, что формула универсального лекарства так и не осенит ни одну многоумную голову. Что же тогда делать рядовым гражданам, чтобы предотвратить свое заражение? До сих пор ученые практически не обращали внимания на коронавирусы, поражающие человека. Однако среди животных эта группа вирусов вызывает целый спектр заболеваний, представляющих немалую угрозу для сельского хозяйства. Про эти вирусы известно довольно много, и, самое главное, разработаны вакцины для животных, предотвращающие развитие заболеваний. Вот только которая из них будет эффективна против вируса SARS?

    При создании вакцины, содержащей только вирусные белки, можно столкнуться с проблемой создания общего иммунитета (обеспеченного IgG), но полного отсутствия местного иммунитета (обусловленного выработкой секреторного IgA в эпителиальных клетках легких). Несмотря на это, многие вакцины для животных приготовлены из вирусных белков. В состав вакцины так же входят вспомогательные вещества - адъюванты, провоцирующие усиление иммунной реакции. Для человека такая методика пока не применима, поскольку безопасный адъювант, не вызывающий всяких серьезных побочных явлений (вплоть до аутоиммунных реакций) пока не обнаружен.

    Вакцины, содержащие живой ослабленный штамм вируса применяются интраназально, что дает несомненный эффект выработки местного иммунитета. Гены, ликвидация которых превратит опасный SARS-CoV в безобидный вакцинный вирус уже обнаружены (они аналогичны неструктурным генам, вырезанным из кошачьего коронавируса для создания вакцины для кошек). Но тут возникает вполне закономерный вопрос - что делать с рекомбинацией? Поскольку обмен генами еще никто не отменял, шанс заработать новое заболевание при применении вакцины с живым вирусом отнюдь, к сожалению, немал.

    Вопрос о скорости мутации SARS-CoV остается пока открытым, поскольку имеются разные данные. Однако в целом для коронавирусов животных характерна высокая скорость мутации. Значит, новые штаммы могут возникнуть сразу же после создания вакцины - как это случилось с коронавирусом кур, вызывавшим бронхит (теперь он поражает почки).

    Пока наиболее перспективным видится создание искусственной вакцины на основе менее опасного живого вируса (например, аденовируса) в качестве генноинженерного вектора, несущего характерные SARS-овые гены. При местном применении такой вакцины должен развиваться правильный местный иммунитет, и в то же время отсутствует возможность губительной рекомбинации. Загвоздка пока состоит в тщательном тестировании полученных вакцин на безопасность, ведь требования ВОЗ очень строги.

    Лабораторная диагностика SARS - инфекции

    Сложная ситуация, обусловленная недавним появлением и быстрым распространением по всему миру вируса SARS, побудила исследователей различных стран направить свои усилия на разработку быстрых и точных лабораторных методов диагностики этого возбудителя. Однако разработка диагностических тестов для этого заболевания вызвала гораздо больше вопросов, чем ожидалось. Проблема оказалась сложнее, чем думали.

    Тем не менее, в настоящее время уже разработан ряд диагностикумов. Они использовались в разных странах для идентификации возбудителя этого заболевания. Однако, по мнению ВОЗ, до тех пор, пока эти тесты не пройдут соответствующие полевые испытания и их надежность не будет полностью доказана, диагностика SARS будет продолжать зависеть от клинических данных. Это требование отражено в современном определении предполагаемого и вероятного случая ТОРС (SARS), данном ВОЗ (уже изложенном выше). На данный момент, в некоторых странах (Канада, Франция, Германия, Гонконг, Япония, Нидерланды, Сингапур, Великобритания и США) с помощью тестов в экспериментальных условиях исследуются образцы предполагаемых или вероятных больных SARS.

    По мнению ВОЗ, при интерпретации результатов тестов следует учитывать ряд моментов. Позитивные результаты теста показывают, что ТОРС (SARS) пациенты недавно были инфицированы SARS вирусом. Негативные результаты теста не должны быть утверждением, что пациент не имеет SARS вируса. Причинами для негативных результатов у пациентов с ТОРС (SARS) может быть следующее:

  • Пациент не инфицирован SARS вирусом; заболевание вызывается другим инфекционным агентом (вирусом, бактерией, грибами) или неинфекционной причиной.
  • Некорректные результаты теста ("false-negative"). Используемый тест необходимо дальше доработать для улучшения его чувствительности.
  • Образцы не были собраны в то время, когда вирус или его генетический материал присутствовал (при использовании метода ОТ-ПЦР или культур клеток). Вирус и его генетический материал в необходимом количестве может присутствовать в человеке очень короткий промежуток времени, в зависимости от типа тестируемого образца.
  • Образцы были собраны до развития заболевания или до того момента, как стали нарабатываться антитела (относится к ELISA и иммунофлюоресцентному анализам).

    Для улучшения понимания процесса развития ТОРС (SARS)-заболевания ВОЗ рекомендует клиницистам проводить последовательный (28 дней) сбор образцов от пациентов с ТОРС (SARS) и сохранять их для тестирования до того момента, когда станут доступными диагностические тесты. Это особенно важно для первичного случая, который выявляется в стране, ранее не докладывавшей о ТОРС (SARS) заболевании. Рекомендации по сбору и транспортировке образцов можно найти на web-сайте CDC (США).

    Согласно рекомендациям ВОЗ, имеется ряд лабораторных тестов, с помощью которых можно выявить, какой вирус является причиной заболевания у человека. В настоящее время они апробируются при диагностике ТОРС (SARS). Однако все эти тесты имеют определенные ограничения для использования.

    Иммунологические тесты - поиск антител.

    Для поиска антител, вырабатываемых организмом человека в ответ на внедрение вируса SARS-CoV, применяют некоторые иммунологические методы. В течение всего периода инфекции в крови больных регистрируются специфические IgG и IgM, причем их количество меняется во времени. На раннем этапе болезни иммунологические методы не работают, поскольку титр антител очень низок. Тестирование антител проводится методами ELISA или IFA. Метод ELISA достоверно выявляет антитела в сыворотке ТОРС (SARS) пациентов, начиная с 21-го дня после появления клинических симптомов заболевания. Иммунофлюоресцентный (IFA) метод выявляет антитела в сыворотке пациентов через десять дней после появления клинических симптомов заболевания. Однако этот метод требует наработки в клеточной культуре вируса SARS, и соответственно, проведения работ в противочумной лаборатории или лаборатории BSL-3 уровня, а так же хороший иммунофлюоресцентный микроскоп и опытного микроскописта.

    Секвенирование генома SARS-вируса завершено, информация о нем лежит в открытом доступе. ОТ-ПЦР-тест (обратно-транскрипционная полимеразная цепная реакция) позволяет выявлять генетический материал SARS-вируса из различных образцов пациента (крови, стуле, респираторных секретов или тканевых жидкостей) и на очень ранних стадиях инфекции. Более того, праймеры, которые являются ключевыми для ПЦР-теста, сейчас сделаны доступными на web сайте ВОЗ и уже используются лабораториями многих стран по всему миру. Существующие ПЦР-тесты являются весьма специфичными, но они пока что недостаточно чувствительны и дают много ложноотрицательных результатов, по которым нельзя исключить наличие SARS-вируса у пациента. Сеть лабораторий ВОЗ работает над своими протоколами и праймерами, чтобы улучшить их достоверность и надежность.

    Сейчас разработаны и предложены 7 праймеров (нуклеотидных фрагментов), с помощью которых можно выявить геном коронавируса, предположительно ответственного за ТОРС (SARS) и которые уже используются различными лабораториями ВОЗ для амплификации ДНК-полимеразного гена коронавирусов. Они в настоящее время исследуются на сравнительную воспроизводимость и чувствительность в различных образцах, с различным временем взятия пробы по ходу заболевания. Результаты ПЦР могут быть использованы в качестве дополнительной клинической оценки. Однако тесты не утверждены лицензионно на подтверждение или исключение случаев заболевания.

    В настоящее время, для диагностики ТОРС (SARS) на сайте ВОЗ различными исследовательскими центрами представлены следующие данные по праймерам, которые могут быть использованы в ПЦР-диагностикумах:

    1. Bernhard-Nocht Institute (Bernhard-Nocht Str. 74 D-20359 Hamburg, Germany).

    BNIoutS/BNoutAs: sense ATGAAT TAC CAA GTC AAT GGT TAC antisense CAT AAC CAG TCG GTA CAG CTA C FraGment lenGth 195 bp

    BNIinS/BNIAs: sense GAA GCT ATT CGT CAC GTT CG antisense CTGTAGAAA ATC CTA GCT GGA G Fragment length 110 bp

    SAR1s/SAR1as: sense CCT CTC TTG TTC TTG CTC GCA antisense TAT AGT GAG CCG CCA CAC ATG Fragment length 150 bp

    Amplicon sequence (BNI-1, Bernhard-Nocht Institute, Hamburg, Germany) TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCA AGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTAT TCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCAT GCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGA TTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTTGA CACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCC ACCAGGTGACCAGTTTAAACATCTTATACC

    2. Centers for Disease Control & Prevention (National Centers for Infectious Diseases, Atlanta GA 30333 1600 Clifton Road, NE, MS-C12 United States)
    SARS-specific primers:
    Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG 3'
    Cor-p-F3 (+) 5'GCCTCTCTTGTTCTTGCTCGC 3'
    Cor-p-R1 (-) 5'CAGGTAAGCGTAAAACTCATC 3'
    Product size
    Cor-p-F2/Cor-p-R1:368 bp
    Cor-p-F3/Cor-p-R1 :348 bp

    3. Government Virus Unit 9/F Public Health Laboratory Centre (382 NAm Cheong Street Shek Kip Mei Kowloon, Hong Kong SAR Hong Kong - SAR China)

    COR-1,COR-2: sense 5' CAC CGT TTC TAC AGG TTA GCT AAC GA 3' antisense 5' AAA TGT TTA CGC AGG TAA GCG TAA AA 3' Product size: 310 bp

    4. Queen Mary Hospital (The University of Hong Kong University Pathology Building Hong Kong - SAR China)

    HKU:      sense     5'    TACACACCTCAGCGTTG      3' antisense     5'    CACGAACGTGACGAAT     3' Product size 182 bps [23]

    По сообщениям газеты Reuters, немецкая биотехнологическая компания "Artus GmbH" начала распространение разработанного ее сотрудниками экспресс-теста для диагностики ТОРС (SARS). Согласно заявлению представителей компании, на разработку этого теста ушло всего две недели. Разработанная "Artus GmbH" совместно с "Bernhard-Nocht Institute for Tropical Medicine" тест-система представляет собой комплект реагентов для проведения полимеразной цепной реакции (ПЦР) для выявления РНК коронавируса, предположительно вызывающего ТОРС (SARS). В качестве объекта для диагностики может использоваться любой биологический материал - кровь, мокрота, кал, моча, мазки со слизистой носоглотки. Собственно процедура анализа занимает не более четырех часов, причем положительные результаты могут быть получены не через две недели после инфицирования, как в случае обычных иммунологических тестов, а практически сразу же после попадания вируса в ткани.

    В настоящее время компания "Artus GmbH" бесплатно поставляет тест-комплекты в страны Азии, наиболее пострадавшие от вспышки SARS, а также в Австралию, США, Скандинавские страны и Германию, где были зарегистрированы отдельные случаи заболевания.

    Имеющиеся ОТ-ПЦР-диагностикумы пока что детектируют только 200-500 из 29000 пар нуклеотидов генома вируса SARS-CoV. Остается определить, какая область генома может быть оптимальной мишенью для диагностического набора. Это является сейчас основной задачей для исследователей.

    Согласно официальному отчету института Beijing Genomics Китайской академии наук вирус SARS очень быстро мутирует, поэтому необходимо тщательно изучить много штаммов, чтобы создать точные диагностические тесты и эффективные способы лечения. Коронавирусы обладают потенциалом изменяться больше, чем другие РНК-вирусы. Главным образом, это происходит потому, что их геном значительно больше и высокая частота рекомбинации является их особенностью. Американские исследователи считают, что рекомбинация, вероятно, ограничивается лишь обменом фрагментами генома с близкородственными вирусами. В случае с SARS-вирусом необходимо провести тщательный филогенетический анализ для определения того, приобрел ли этот вирус какую-нибудь генетическую информацию путем рекомбинации с хорошо известными коронавирусами животных. По данным сингапурских ученых (Эдисн Лиу, Институт генома в Сингапуре) вирус SARS неожиданно оказался относительно стабильным. Вирусы, выделенные от различных пациентов, оказались практически одинаковыми, а все наблюдавшиеся вариации возникали только у вирусов, выращенных in vivo.

    Четкие позитивные результаты ПЦР показывают, что генетический материал (РНК) присутствует в данном образце, но это отнюдь не означает, что именно этот вирус вызвал инфекцию или что его титр достаточно высок, чтобы вызвать заражение окружающих. Негативные результаты ПЦР опять же не говорят об отсутствии SARS. Кроме шанса получить false-negative результат, можно еще и не вовремя отобрать образцы для исследования (генетический материал в них еще или уже не представлен). По этому поводу в России даже издана специнструкция - как правильно и единообразно производить забор проб для ПЦР в случае подозрения на SARS инфекцию. Таким образом, несмотря на высокую чувствительность этого метода, применение его для точной диагностики пока сопряжено с определенными трудностями и допущениями. ВОЗ призывает все страны, занимающиеся разработкой и применением этих тест систем объединиться для достижения более точных результатов и для перепроверки положительных данных.

    3. Культура клеток.

    Вирус в образцах ТОРС (SARS) пациентов (респираторные секреты, кровь и стул) может быть также выявлен при помощи инфицирования культур клеток (например, линии Vero) и последующей наработки вируса. Выделенный вирус может быть идентифицирован как SARS-вирус дополнительными тестами. Культура клеток является очень требовательным методом, однако в то же время и единственным способом показать наличие живого вируса.

    Заключение

    В начале июля ВОЗ установила окончание эпидемии атипичной пневмонии - от нее избавились в Канаде, в Китае и на Тайване. Прошло более 2 максимальных инкубационных периодов с момента возникновения последнего случая SARS. Может ли медицинская общемировая общественность, да и рядовые граждане вздохнуть свободно? Есть ли у населения поводы для паники, или стоит забыть про все это, как про страшный сон? К сожалению, ученые все больше опасаются, что вирус SARS способен принять еще более опасную форму, и ждать его второго пришествия осталось совсем недолго - как только в северное полушарие придут холода и начнется обычная для этого времени года эпидемия простуд. К сожалению, несмотря на фантастически быструю расшифровку возбудителя, определение его основных свойств и принятие жесточайших карантинных мер в очагах распространения инфекции, прошло слишком мало времени для разработки сколь ни будь эффективных методов борьбы с этим заболеванием

    Поскольку количество случаев SARS в последние месяцы неуклонно снижается, возникает закономерный вопрос - возможно ли полное уничтожение этого заболевания, или же уничтожение его у нового носителя - человека. Ведь известно (памятуя примеры оспы и полиомиелита), что для уничтожения инфекции необходимо выполнить 3 условия: во-первых, необходимо разорвать механизм передачи инфекции, например, разработать и сделать общедоступной эффективную вакцину. Во-вторых, необходимы легкие в использовании диагностические тесты с достаточной чувствительностью и специфичностью, чтобы определить наличие инфекции в организме при том количестве возбудителя, которое может привести к дальнейшему ее распространению. И, наконец, третье - передача инфекции от человека к человеку должна являться основным звеном в жизненном цикле вызывающего ее вируса. Если эта цепь передачи будет прервана, данный инфекционный агент не сможет выжить. Наличие природного очага инфекции значительно усложняет ликвидацию болезни, но не препятствует этому, добавляя к мерам, направленным на прерывание механизма передачи инфекции еще и разрыв цепи передачи от животных.

    Текущие меры контроля за SARS являются достаточно эффективными, но весьма затратными в экономическом плане. Немногие страны способны соблюдать такие правила постоянно. До конца не определен источник инфекции, природные хозяева вируса так же под вопросом. Дальнейших доработок требует и диагностические тесты. В общем, впереди научный мир ожидает непочатый край работ, который, как бы мрачно это не звучало, будет подстегиваться все новыми и новыми случаями заражения уже через несколько месяцев. Будем законопослушными китайцами - предстоящую осень и зиму нам скорее всего придется провести в марлевых повязках в ожидании от ученых положительных результатов испытаний эффективной вакцины или нового лекарства.

    Автор статьи: Анастасия Охапкина.


    Список использованных материалов:

    1. Epidemic curves - Severe Acute Respiratory Syndrome (SARS). 2003. Сайт ВОЗ http://www.who.int/csr/sarsepicurve/epiindex/en/index1.html
    2. Preliminary Clinical Description of Severe Acute Respiratory Syndrome.// MMWR Weekly. 2003. V.52. N12. P. 255-256. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5212a5.htm
    3. Clinical hold virtual conference on management of SARS patients. Сайт ВОЗ. 2003. www.who.int/csr/clinicansconference/en.print.html
    4. Hsu L-Y, Lee C-C, Green JA, et al. Severe acute respiratory syndrome (SARS) in Singapore: clinical features of index patient and initial contacts. // Emerg. Infect. Dis. [serial online] 2003. http://www.cdc.gov/ncidod/EID/vol9no6/03-0264.htm
    5. Updated Interim U.S. Case Definition of Severe Acute Respiratory Syndrome (SARS). 2003. http://www.cdc.gov/ncidod/sars/casedefinition.htm
    6. Outbreak of Severe Acute Respiratory Syndrome ---Worldwide, 2003. MMWR Weekly// 2003. V.52. N11. P. 226-228. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5211a5.htm
    7. Case Definitions for Surveillance of Severe Acute Respiratory Syndrome (SARS). Сайт ВОЗ. 2003. http://www.who.int/csr/sars/casedefinition/en/
    8. PCR primers for SARS developed by WHO Network Laboratories. 2003. Сайт ВОЗ. http://www.who.int/csr/sars/primers/en/
    9. Heymann D. L. Status of the global SARS outbreak and lessons for the immediate future. 2003. Сайт ВОЗ. http://www.who.int/csr/sarsarchive/2003_04_11/en/tests
    10. SARS: Availability and use of laboratory testing. 2003. Сайт ВОЗ. http://www.who.int/csr/sars/testing2003_04_18/en/
    11. Blenkinsop P. German Firm Distributes First Sars Test Worldwide. 2003. http://www.nlm.nih.gov/medlineplus/news/fullstory_12350.html
    12. Progress in genome sequencing of Chinese isolates of SARS virus. 2003. http://www.gpbjournal.org/sars.jsp
    13. Shared mutations in the genomes of SARS coronaviruses. 2003. http://www.biomedcentral.com/news/20030416/04
    14. Zhang J.Z. Severe acute respiratory syndrome and its lesions in digestive system. 2003. J Gastroenterol. Jun; 9(6): 1135-1138
    15. Nie Qing-He, Luo Xin-Dong, Hui Wu-Li. Advances in clinical diagnosis and treatment of severe acute respiratory syndrome/ 2003/ J/ Gastroenterol. Jun; 9(6): 1139-1143
    16. Holmes K.V. SARS coronavirus: a new challenge for prevention and therapy. 2003. J.Clin. Investig. 111:1605-1609
    17. Zelus B.D., Schinckli J.H., Blau D.M., Weiss S.R. and Holmes K.V. 2003. Conformation changes in the spike glycoprotein of murine coronavirus are indicated at 37C either by soluble murine CEACAM1 receptors or by ph 8. J.Virol. 77: 830-840
    18. Rota P.A. et al. 2003. Characterisation of novel coronavirus associated with severe acute respiratory syndrome. Science. Doi:10.1126/science.10859553
    19. Z. Zhao, F. Zhang, M. Xu, K. Huang, W. Zhong, W. Cai, Z. Yin, S. Huang, Z. Deng, M. Wei, J. Xiong, and P. M. Hawkey. 2003. Description and clinical treatment of an early outbreak of severe acute respiratory syndrome (SARS) in Guangzhou, PR China. Journal of Medical Microbiology 52, 715-720
    20. Атипичная пневмония (SARS). Этиология, патогенез, клиника, статистика. 2003. http://www.rusmg.ru
    21. Нетесов С.В. и др. Тяжелый острый респираторный синдром (ТОРС), вызываемый коронавирусом. 2003. http://www.gsen.ru


  • Rusbiotech™
    Copyright © 2000-2003 Rusbiotech
    designed by Интерруссофт © 2003



    

       Яндекс цитирования    ЧИСТЫЙ ИНТЕРНЕТ - www.logoSlovo.RU   TopList